پاورپوینت های علوم پایه

نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی   نگرش های مولکولی و فیزیولوژیکی به تحمل خشکسالی آب عامل اصلی محدود کننده در کشاورزی جهان می باشد. در کل اغلب گیاهان زراعی، حتی به یک تنش ملایم از دست دادن آب نیز به دشت حساس هستند.   با وجود این، چند جنس از گیاهان مختص آفریقای جنوبی وجود دارند که قابلیت بسیار بالا برای مقاومت در برابر از دست دادن آب و خشک شدن را دارند. به این جنس ها، گیاهان قیامت "resurrection Plants" گفته می شود. ما از Xerophta viscose به عنوان نمونه گیاهان قیامت (تک…

نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی

نگرشهای مولكولی و فیزیولوژیكی به تحمل خشكسالی

 

نگرش های مولکولی و فیزیولوژیکی به تحمل خشکسالی

آب عامل اصلی محدود کننده در کشاورزی جهان می باشد. در کل اغلب گیاهان زراعی، حتی به یک تنش ملایم از دست دادن آب نیز به دشت حساس هستند. 

 

با وجود این، چند جنس از گیاهان مختص آفریقای جنوبی وجود دارند که قابلیت بسیار بالا برای مقاومت در برابر از دست دادن آب و خشک شدن را دارند. به این جنس ها، گیاهان قیامت "resurrection Plants" گفته می شود.

ما از Xerophta viscose به عنوان نمونه گیاهان قیامت (تک لپه ای) استفاده کردیم تا ژن های مرتبط با تحمل فشار اسمزی را استخراج کنیم. چندین ژن که بصورت متمایز بیان می شوند، در سطوح بیوشیمایی و ملکولی مورد مطالعه قرار گرفتند. این ژنها همان هایی هستند که قابلیت عملکردی خوبی به اشریشیاکلی در شرایط تنش اسمزی می دهند. ما در این مقاله از این آزمایش به عنوان پایه ای برای بحث درباره نگرش های ملکولی و فیزیولوژیکی به تحل خشکسالی، استفاده خواهیم کرد.

(osmoprotectants)، آبسیزیک اسید (ABA) و عوامل رونویسی

مقدمه:

آب یک جزء مهم و اساسی در متابولیسم تمام ارگانیسم های رانده است. آب، انجام شدن بسیاری از واکنش های حیاتی زیست شناختی را بوسیله دارا بودن خصوصیاتی نظیر حلالیت، فراهم کردن محیط انتقال، سرد کردن محیط از راه تبخیر، تسهیل می کند. (Bohert et al., 1995).

در گیاهان و سایر فتواتوتروف ها، آب نقش مهمی در فراهم کردن انرژی مورد نیاز برای پیشبرد فتوسنتز دارد. ملکولهای آب، طی فرآیندی بنام اتولیز شکسته شده و الکترونهایی بر جای می گذارند که این الکترونها برای به چرخه درآوردن انرژی نوری ذخیره شده در فتوسیستم II ضروری می باشند. (Salisbury an Ross, 1992a)

یکی از پیامدهای مهم تنش خشکی، از دست دادن آب پروتوپلاسمی است که منجر به افزایش غلظت یونهایی مانند  می شود. در غلظت های بالا چنین یونهایی به طور موثری مانع عملکرد متابولیکی می شوند (Hartung et al., 1998). همچنین افزایش غلظت اجزای تشکیل دهنده پروتوپلاسم و از دست دادن آب سلول باعث ایجاد وضعیت خاصی به نام «حالت شیشه ای: glassy state» می شود. در این حالت، ویسکوزیته مایع موجود در داخل سلول بیشتر می شود که در نتیجه باعث افزایش احتمال برهم کنش های مولکولی و واسرشت شدن پروتئین ها و فیوژن غشا می شوند. (Hartung et la., 1998; Hoekstra et al., 2001).

بنابراین گیاه برای حفظ تورگور سلولی و عملکردهای متابولیکی نیاز به بیان ژنهای خاصی دارد. گروه تحقیقاتی ما می کوشد گیاهان تراژنی زراعی و همچنین وحشی را که قادر به مقاوت در برابر خشکی باشند، ایجاد کند. منبع ژنها گیاهی به نام Xerophyta viscose (Baker) از خانواده Vello=iaceae است که متعلق به گروه کوچکی از نهاندانگان می باشد. این گیاه به علت قابلیت فوق العاده تحمل خشکی به «گیاه قیامت» ملقب شده است (Farrant, 2000, Gaff, 1977).

این گیاه (X. viscose) تا 5 درصد محتوای آب نسبی (RWC) می تواند آب از دست دهد و آبیاری مجدد این گیاه تقریباً به مدت 80 ساعت آنرا سیراب کرده و گیاه فعالیت های یزیولوژیکی خود را از سر می گیرد. (Sherwin and Farront, 1998).

ژنهایی که در این مقاله مورد بررسی قرار خواهند گرفت، شامل موارد زیر هستند: (XVPer 1 (کد کننده یک آنتی اکسیدان)، VATP1XV (کد کننده یک پروتئین زیر واحدی C مانند از آنزیم –H+ آدنوزین تری فسفاتاز)، XVGOLS (کد کننده یک گالاکتینول سنتاز)، ALDRXV4 (کد کننده یک آلدوز ردوکتاز)، XVSAP1 (کد کننده یک پروتئین متصل شونده به غشای سلولی) و DREB1A (کد کننده یک عامل رونویسی). برای تعیین اثرات ناشی از بیان این ژنها در تک لپه ای ها، آنها را به گیاه علفی بنام Digitaria sanguinalis انتقال دادیم و برای انتقال این ژنها خودمان یک سیستم انتقال طراحی کرده ایم (chen et al., 1998). سپس اگر نتایج مثبت باشند، ژنها به محصولات زراعی مانند ذرت (Zea mays) نیز منتقل خواهند شد. برای انجام چنین کاری بر روی دو لپه ای ها، ما نخست آن ژن ها را به Arabidopsis thaliana و Nicotina tobacum منتقل می کنیم.

پدیده تحمل خشکی یک پدیده پیچیده است که شامل بیان سازمان یافته ژنهای زیادی است (Walters et la., 2002) به عبارت دیگر، برای بدست آوردن گیاهان مقاوم در برابر خشکی، چند ژن باید به طور همزمان بیان شوند (Co-expression).

به عنوان مثال، بیان XVPer1، که به نظر می رسد DNA را در برابر گونه های فعال اکسیژن محافظت می کند، همزمان با بیان XVSAP1، که احتمالاً از تراوایی غشا جلوگیری می کند، همراه با بیان XVGOLS و ALDRXV4 که هر دو محافظت کننده اسمزی هستند، مجموعه ای از پروتئین های مرتبط به هم را نتیجه می دهد که با همکاری یکدیگر خصوصیت مقاومت در برابر خشکی را نتیجه می دهند.

برخی تغییرات ساختاری و فیزیولوژیکی ایجاد شده در سطح سلولها و در نتیجه در تمام پیکر گیاه از آنجائیکه پاسخ گیاهان به خشکی پیچیده و مختلف است، بنظر نمی رسد که فقط یک ژن در ایجاد تحمل خشکی نقش داشته باشد. بنابراین نیاز به درک پاسخ فیزیولوژیکی گیاهان تحت شرایط کمبود آب از اهمیت خاصی برخوردار است. (رجوع شود به Alpert and Oliver, 2002; Levitt, 1980, Walters et la. 2002 برخلاف گیاهان عادی، که پتانسیل آب را بالاتر از محیط حفظ می کنند و تلاش می کنند به فعالیت خود در دوره های کمبود آب ادامه دهند، گیاهان مقاوم خشکی یک استراتژی کاملاً متفاوت را به کار می گیرند: بافت های زنده تمام آب آزاد خود را از دست می دهند و سپس به طور آنی آب در دسترس بافت ها قرار می گیرد. این توانایی غیرعادی برای بقا در فقدان شدید آب در بافتهای زنده فقط در 100 نهاندانه مشاهده شده است (Gaff, 1977). اگر چه گیاهان قیامت ارزش اقتصادی چندانی برای کشاورزی ندارند، فهم بیشتر این پدیده می تواند نگرشهایی در مکانیسم های ممکن برای بهبود مقاومت گیاهان زراعی، ایجاد کند. در واقع روشهای زیادی وجود دارد که بوسیله آنها گیاهان مختلف به خشکسالی پاسخ می دهند (خلاصه شده در نمودار 1)

هستند (مثل ذرت)، باشد.

پایداری غشای سلولی

غشای سلولی نقش مهمی در حفظ انسجام سلولی، شرکت در انتقال سیگنالها، و در همئوستازی یونی در شرایط تنش خشکی بر عهده دارد. شوک اسمزی به سلولهای حساس به اسمز منجر به آسیب جبران ناپذیر غشای سلولی می شود. از سوی دیگر سلولهای مقاوم اسمزی اگر دارای مکانیسم های درونی شرکت کننده در پایداری غشا باشند می توانند دقت تنش آب زنده بمانند. شوک اسمزی شامل یک تغییر جزئی القاء شده بوسله دوگانه دوتسی در غشاء است که در هنگام شروع خشک شدن ظاهر می شود و نشان داده شده است که عملکرد سیگنالی دارد. سیگنال القاء شده بوسیله تغییر غشاء منجر به بیان پروتئین های فراوان embrycgenesis متأخر و پروتئین های شوک حرارتی در دانه ها می شوند. در طی دهیدراته شدن، ترکیبات دوگانه دوست سیتوپلاسمی از لحاظ غلظت و partition در غشاء افزایش می یابند و باعث اختلال در هم سلولهای حساس و هم سلولهای مقاوم می شوند. در مرحله میانی، در سلولهای مقاوم، حضور محلولها (قندها) سطح غشار را هیدراته نگه می داد رو از fusion غشا جلوگیری می کند. پایین تر از 0.3 گرم آب در g1 وزن خشک سلولی، ملکولهای قند در سلولهای مقاوم آب را در پوشش هیدراسیون غشا جاسازی می کنند و در نتیجه فضای بین ملکولهای فسفولیپید را حفظ می کنند.

Grawe et la., 2002 پینشهاد کرده است که یک CDNA، X VSAP1 از مجموعه CDNA استخراج شده از برگهای دهیدراته شده X. viscosa، نقشی در پایداری غشاء ایفا می کند. XVSAP1 خصوصیات مشترک زیادی با خانواده انتقال دهنده های k+ دارد. XVSAP1 پیش بینی شده شامل یک پروتئین سیار آبگریز با دو مکان برای اتصال چربی سیپوپروتئین به غشا می باشد. حضور این مکان ها مفهومی را تقویت می کند که بیان می کند: XVSAP1 به صورت کاملاً نزدیک با غشای سلولی ارتباط دارد و می تواند یکی از ترکیبات شکرت کننده در تعمیر آسیب غشایی ناشی از کمبود آب باشد.

بیان ژنهای پاسخی به تنش توسط مکان یابی عوامل رونویسی

ژنهای القاء شده در شرایط تنش کمبود آب می توانند به دو گروه تقسیم شوند. الوی پروتئین هایی را که مستقیماً در حفاظت نقش دارند و دومی پروتئین هایی را که در تنظیم transduction سیگنالی و بیان ژن نقش دارند، کد می کند. بعد از احساس کمبود آب توسط سلول، مکانیسم سیگنالی باید فعال شود تا ژنهای خاصی را برانگیخته کند. شرایط مختلف، ژنهای القاء شده توسط تنش مختلفی را برانگیخته می کند و بنابراین باید چندین مکانیسم سیگنالی مختلف وجود داشته باشد.یکی از سیگنال های اصلی عمل کننده در XVSAP1 تنش آب، هورمون گیاهی آبسیزیک اسید، ABA، است. مطالعات روی ABA، نشان داده است که این هورمون در چندین فرآیند فیزیولوژیکی و تکاملی مختلف (که این فرآیندها بر روی فعالیت های زراعی مانند بلوغ جنین و جوانه زنی تأثیر می گذارند)، علاوه بر پاسخ بافت های زنده و تنش اسمزی، وساطت می کند. ABA در نتیجه تنش آب افزایش پیدا می کند و نقش های مهمی در مقاومت گیاهان در برابر خشکی، شوری بالا و سرما دارد.

الگوهای بیان ژن های القا شده بوسیله خشکی پیچیده اند. بعضی از ژنها خیلی سریع به تنش پاسخ می دهند در حالیکه، بعضی دیگر به آهستگی بعد از انباشته شدن ABA برانگیخته می شوند. اکثر ژنهایی که به خشکی پاسخ می دهند همچنین بوسیله کاربرد ABA exogenous برانگیخته می شوند. برخی از ژنها وجود دارند که بوسیله تنش خشکی برانگیخته می شوند اما در هنگام مواجه شدن با exogenous ABA پاسخی نمی دهند. این یافته ها وجود هم زمان جریانها آبشاری سیگنالهای وابسته به ABA و مستقل از ABA را بین سیگنال اولیه تنش خشکی یا سرما و یان ژنهای خاص را نشان می دهند. این ژنهای القاء شونده بوسیله دهیدراته شدن شامل عناصر بالقوه پاسخ دهنده به ABA (ABREها) با تولای (Py ACGT GGC) در ناحیه پروموتور خود هستند. یک ABRE به عنوان یک عنصر DNA Cis-acting شرکت کننده در بیان ژنهای تنظیم شده بوسیله ABA عمل می کند و اولین بار در Em گندم و ژنهای rab برنج شناسائی شده بود. یک پروتئین متصل شونده به DNA و ABRE بنام EmBP-1 نشان داده شده است که یک پروتئین Bzip را کد می کند. G-box موتیف ABRE را مجتمع می کند و در تنظیم ژنها گیاه در شرایط مختلف محیطی عمل می کند. یک عنصر جفت شونده مورد نیاز است تا بتوان عملکرد ABRE را که یک مجموعه پاسخی از به ABA را تشکیل می دهد، در تنظیم ژن HVA22 مشخص کرد. سایر عناصر Cis-acting که در بیان ژنهای پاسخی به ABA، نه فقط در شرایط تنش خشکی بلکه همچنین درخشک شدن دانه عمل می کنند. جعبه Sph و جایگاه های اتصال MYC, MYB در ژن Arabilopsis rd22 می باشند. اخیراً یک عامل رونویسی (CPR18) ا زگیاه قیامت Craterostigma plantagineum که به ناحیه پروموتوری الزامی برای بیان با واسطه ABA ژن CdeT27-45 متصل می شود، استخراج شده است. این ژن دارای یک ناحیه Cis-regulatory 29 جفت بازی (AAGCCCAAATTTCACAGCCCGATA) است که در پروموتور ژن Cde27-45 از C.plantagineum موجود است.

قیمت فایل فقط 5,000 تومان

خرید


مراحل خرید:


1- پیش از خرید محصول توضیحات آن را به دقت مطالعه کنید زیرا محتوای فایل شامل تمام آن چیزی است که در توضیحات نوشته شده (نه کمتر و نه بیشتر)

2- پس از انتخاب فایل مورد نظر خود روی دکمه "دانلود" کلیک کنید
3- در مرحله بعد و در قسمت "تکمیل فرم خرید" مشخصات خواسته شده را به دقت وارد کنید و سپس روی دکمه "پرداخت و دانلود فایل" کلیک کنید.

(ایمیل را بدون www وارد کنید. نمونه صحیح ایمیل:  gsmyha@gmail.com)
3- در این مرحله به صفحه پرداخت وارد شده و با تمام کارت های عضو شتاب می توانید هزینه را واریز نمایید
4- پس از پرداخت موفق مجددا به سایت برگردانده می شوید و لینک دانلود برای شما نمایش داده می شود و علاوه بر آن یک نسخه از فایل به ایمیل شما هم ارسال می گردد تا با خیال راحت فایل خود را دانلود کنید.

(در صورتی که ایمیل فایل ناب به صندوق ورودی شما نرسیده ، باید پوشه اسپم را در ایمیل خود باز کنید و آنرا به صندوق ورودی انتقال دهید تا لینک دانلود فعال شود)


چند نکته مهم:

* پس از خرید فایل تا سه روز فرصت دارید تا فایل را بررسی کنید و در صورتی که فایل مطابق با توضیحات ارائه شده نبود از طریق بخش "تماس با ما" جزییات خرید را برای ما ارسال کنید تا پس از بررسی ، هزینه پرداختی شما را به حسابتان واریز کنیم.


* برای خرید محصولاتی که کمتر از 5000 تومان قیمت دارند نمی توانید از کارت بانک ملی استفاده کنید چون بانک ملی این اجازه را به دارندگان کارت بانک ملی نداده و به همین دلیل پیشنهاد می شود که برای خریدهای کمتر از 5000 تومان از کارت سایر بانکها استفاده نمایید.


* اگر صفحه لینک دانلود ظاهر نشود علت آن گزارش تخلف فایل و غیر فعال شدن فایل از طرف سایت می باشد. در این شرایط از طریق بخش "تماس با ما" جزییات خرید را برای ما ارسال کنید تا پس از بررسی ، هزینه پرداختی شما را به حسابتان واریز کنیم.

1  در هنگام خرید فایل به هیچ وجه از وی پی ان استفاده نکنید زیرا به احتمال زیاد خرید شما موفق نخواهد بود.


* در هنگام خرید از مرورگرهای فایرفاکس و کروم استفاده کنید و به هیچ وجه از مرورگر اینترنت اکسپلورر استفاده نکنید چون با توجه به آپدیت نشدن این مرورگر در چند سال اخیر ، در فرایند خرید و دانلود فایل اختلال بوجود خواهد آمد.

2 دانلود مرورگر گوگل کروم (نسخه 32 بیتی)

2 دانلود مرورگر گوگل کروم (نسخه 64 بیتی)

3 دانلود مرورگر فایرفاکس (نسخه 32 بیتی)

3 دانلود مرورگر فایرفاکس (نسخه 64 بیتی)


* برای حفظ کیفیت و همچنین دانلود آسانتر ، تمامی فایل ها فشرده شده و با فرمت rar یا zip آپلود شده اند. برای باز کردن فایل باید حتما نرم افزار win rar بر روی سیستم شما نصب شده باشد.

4 دانلود نرم افزار win rar (نسخه 32 بیتی)

4 دانلود نرم افزار win rar (نسخه 64 بیتی)


* در صورتی که از گوگل بصورت مستقیم به بخش دانلود وارد شده اید ، می توانید روی نام فایل کلیک کنید تا توضیحات فایل برای شما نمایش داده شود.

* برای سهولت دانلود فایل ها توسط شما عزیزان پیشنهاد می کنیم که از نرم افزار اینترنت دانلود منیجر استفاده کنید.

5 دانلود نرم افزار اینترنت دانلود منیجر

با آرزوی خریدی مطمئن برای شما

پاورپوینت های مرتبط
ارسال نظر برای این مطلب

نام
ایمیل (منتشر نمی‌شود)
وبسایت
:) :( ;) :D ;)) :X :? :P :* =(( :O @};- :B :S
کد امنیتی
رفرش
کد امنیتی
نظر خصوصی
مشخصات شما ذخیره شود ؟ [حذف مشخصات] [شکلک ها]
تبلیغات
محل تبلیغات شما
آرشیو
آمار سایت
  • کل پاورپوینت ها: 1988
  • کل نظرات : 1